ID: 937003669

View in Genome Browser
Species Human (GRCh38)
Location 2:118491371-118491393
Sequence GAAAATGCAGAGGTACAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003667_937003669 -5 Left 937003667 2:118491353-118491375 CCTTCGGCAGCTCTTTGGGAAAA No data
Right 937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG No data
937003662_937003669 17 Left 937003662 2:118491331-118491353 CCAACTGCTCCTCATGCACAAAC No data
Right 937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG No data
937003664_937003669 8 Left 937003664 2:118491340-118491362 CCTCATGCACAAACCTTCGGCAG No data
Right 937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003669 Original CRISPR GAAAATGCAGAGGTACAGCA TGG Intergenic
No off target data available for this crispr