ID: 937003949

View in Genome Browser
Species Human (GRCh38)
Location 2:118494073-118494095
Sequence GGGTGACAACAATTGCGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937003949_937003957 13 Left 937003949 2:118494073-118494095 CCGGCACGCAATTGTTGTCACCC No data
Right 937003957 2:118494109-118494131 TTCAGACAGAGAAGATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937003949 Original CRISPR GGGTGACAACAATTGCGTGC CGG (reversed) Intergenic
No off target data available for this crispr