ID: 937004108

View in Genome Browser
Species Human (GRCh38)
Location 2:118495885-118495907
Sequence CAATTTAGGCAAAGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937004108_937004118 15 Left 937004108 2:118495885-118495907 CCCTTCACCCTTTGCCTAAATTG No data
Right 937004118 2:118495923-118495945 GGGACTTTTTAGAATATCCTGGG No data
937004108_937004115 -6 Left 937004108 2:118495885-118495907 CCCTTCACCCTTTGCCTAAATTG No data
Right 937004115 2:118495902-118495924 AAATTGGTAATTTTAACTCTGGG No data
937004108_937004116 -5 Left 937004108 2:118495885-118495907 CCCTTCACCCTTTGCCTAAATTG No data
Right 937004116 2:118495903-118495925 AATTGGTAATTTTAACTCTGGGG No data
937004108_937004114 -7 Left 937004108 2:118495885-118495907 CCCTTCACCCTTTGCCTAAATTG No data
Right 937004114 2:118495901-118495923 TAAATTGGTAATTTTAACTCTGG No data
937004108_937004117 14 Left 937004108 2:118495885-118495907 CCCTTCACCCTTTGCCTAAATTG No data
Right 937004117 2:118495922-118495944 GGGGACTTTTTAGAATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937004108 Original CRISPR CAATTTAGGCAAAGGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr