ID: 937004221

View in Genome Browser
Species Human (GRCh38)
Location 2:118496617-118496639
Sequence GCTGTGGGATGCGGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937004214_937004221 -5 Left 937004214 2:118496599-118496621 CCCATGCCATCTCCTGCAGCTGT No data
Right 937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG No data
937004212_937004221 24 Left 937004212 2:118496570-118496592 CCACCTACTTTGCTGGCTTGTAG No data
Right 937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG No data
937004215_937004221 -6 Left 937004215 2:118496600-118496622 CCATGCCATCTCCTGCAGCTGTG No data
Right 937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG No data
937004213_937004221 21 Left 937004213 2:118496573-118496595 CCTACTTTGCTGGCTTGTAGTCA No data
Right 937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937004221 Original CRISPR GCTGTGGGATGCGGCCGCCC TGG Intergenic
No off target data available for this crispr