ID: 937007138

View in Genome Browser
Species Human (GRCh38)
Location 2:118527477-118527499
Sequence ATCCATTTTCTAATGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937007136_937007138 -9 Left 937007136 2:118527463-118527485 CCTGGGAAGAACTCATCCATTTT No data
Right 937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG No data
937007135_937007138 4 Left 937007135 2:118527450-118527472 CCAGACAAGGTGGCCTGGGAAGA No data
Right 937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG No data
937007133_937007138 6 Left 937007133 2:118527448-118527470 CCCCAGACAAGGTGGCCTGGGAA No data
Right 937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG No data
937007132_937007138 7 Left 937007132 2:118527447-118527469 CCCCCAGACAAGGTGGCCTGGGA No data
Right 937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG No data
937007134_937007138 5 Left 937007134 2:118527449-118527471 CCCAGACAAGGTGGCCTGGGAAG No data
Right 937007138 2:118527477-118527499 ATCCATTTTCTAATGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937007138 Original CRISPR ATCCATTTTCTAATGCTGGT TGG Intergenic
No off target data available for this crispr