ID: 937009567

View in Genome Browser
Species Human (GRCh38)
Location 2:118550473-118550495
Sequence GAGAAAAGGTCCTTGAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937009567_937009573 19 Left 937009567 2:118550473-118550495 CCTCAATTCAAGGACCTTTTCTC No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data
937009567_937009569 -7 Left 937009567 2:118550473-118550495 CCTCAATTCAAGGACCTTTTCTC No data
Right 937009569 2:118550489-118550511 TTTTCTCCTGCCTCCAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937009567 Original CRISPR GAGAAAAGGTCCTTGAATTG AGG (reversed) Intergenic
No off target data available for this crispr