ID: 937009569

View in Genome Browser
Species Human (GRCh38)
Location 2:118550489-118550511
Sequence TTTTCTCCTGCCTCCAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937009567_937009569 -7 Left 937009567 2:118550473-118550495 CCTCAATTCAAGGACCTTTTCTC No data
Right 937009569 2:118550489-118550511 TTTTCTCCTGCCTCCAAACTTGG No data
937009564_937009569 6 Left 937009564 2:118550460-118550482 CCCATGTGCATTACCTCAATTCA No data
Right 937009569 2:118550489-118550511 TTTTCTCCTGCCTCCAAACTTGG No data
937009563_937009569 10 Left 937009563 2:118550456-118550478 CCATCCCATGTGCATTACCTCAA No data
Right 937009569 2:118550489-118550511 TTTTCTCCTGCCTCCAAACTTGG No data
937009565_937009569 5 Left 937009565 2:118550461-118550483 CCATGTGCATTACCTCAATTCAA No data
Right 937009569 2:118550489-118550511 TTTTCTCCTGCCTCCAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937009569 Original CRISPR TTTTCTCCTGCCTCCAAACT TGG Intergenic
No off target data available for this crispr