ID: 937009570

View in Genome Browser
Species Human (GRCh38)
Location 2:118550495-118550517
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937009570_937009573 -3 Left 937009570 2:118550495-118550517 CCTGCCTCCAAACTTGGATTTCC No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937009570 Original CRISPR GGAAATCCAAGTTTGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr