ID: 937009571

View in Genome Browser
Species Human (GRCh38)
Location 2:118550499-118550521
Sequence AATGGGAAATCCAAGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937009571_937009573 -7 Left 937009571 2:118550499-118550521 CCTCCAAACTTGGATTTCCCATT No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937009571 Original CRISPR AATGGGAAATCCAAGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr