ID: 937009572

View in Genome Browser
Species Human (GRCh38)
Location 2:118550502-118550524
Sequence GCAAATGGGAAATCCAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937009572_937009573 -10 Left 937009572 2:118550502-118550524 CCAAACTTGGATTTCCCATTTGC No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937009572 Original CRISPR GCAAATGGGAAATCCAAGTT TGG (reversed) Intergenic
No off target data available for this crispr