ID: 937009573

View in Genome Browser
Species Human (GRCh38)
Location 2:118550515-118550537
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937009570_937009573 -3 Left 937009570 2:118550495-118550517 CCTGCCTCCAAACTTGGATTTCC No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data
937009571_937009573 -7 Left 937009571 2:118550499-118550521 CCTCCAAACTTGGATTTCCCATT No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data
937009572_937009573 -10 Left 937009572 2:118550502-118550524 CCAAACTTGGATTTCCCATTTGC No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data
937009568_937009573 5 Left 937009568 2:118550487-118550509 CCTTTTCTCCTGCCTCCAAACTT No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data
937009567_937009573 19 Left 937009567 2:118550473-118550495 CCTCAATTCAAGGACCTTTTCTC No data
Right 937009573 2:118550515-118550537 TCCCATTTGCTTCTACGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type