ID: 937012068

View in Genome Browser
Species Human (GRCh38)
Location 2:118571912-118571934
Sequence TTGTTCTTGTACAAACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937012068_937012069 -4 Left 937012068 2:118571912-118571934 CCAGGCAGTTTGTACAAGAACAA No data
Right 937012069 2:118571931-118571953 ACAACACGTTCCCATGAATTTGG No data
937012068_937012070 -3 Left 937012068 2:118571912-118571934 CCAGGCAGTTTGTACAAGAACAA No data
Right 937012070 2:118571932-118571954 CAACACGTTCCCATGAATTTGGG No data
937012068_937012071 4 Left 937012068 2:118571912-118571934 CCAGGCAGTTTGTACAAGAACAA No data
Right 937012071 2:118571939-118571961 TTCCCATGAATTTGGGAAAGCGG No data
937012068_937012074 30 Left 937012068 2:118571912-118571934 CCAGGCAGTTTGTACAAGAACAA No data
Right 937012074 2:118571965-118571987 GCTGCCAATTCACCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937012068 Original CRISPR TTGTTCTTGTACAAACTGCC TGG (reversed) Intergenic
No off target data available for this crispr