ID: 937012072

View in Genome Browser
Species Human (GRCh38)
Location 2:118571941-118571963
Sequence TTCCGCTTTCCCAAATTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937012072_937012078 14 Left 937012072 2:118571941-118571963 CCCATGAATTTGGGAAAGCGGAA No data
Right 937012078 2:118571978-118572000 CCCAAGCAGGCATTCCAAGCTGG No data
937012072_937012080 19 Left 937012072 2:118571941-118571963 CCCATGAATTTGGGAAAGCGGAA No data
Right 937012080 2:118571983-118572005 GCAGGCATTCCAAGCTGGCCTGG No data
937012072_937012074 1 Left 937012072 2:118571941-118571963 CCCATGAATTTGGGAAAGCGGAA No data
Right 937012074 2:118571965-118571987 GCTGCCAATTCACCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937012072 Original CRISPR TTCCGCTTTCCCAAATTCAT GGG (reversed) Intergenic
No off target data available for this crispr