ID: 937012073

View in Genome Browser
Species Human (GRCh38)
Location 2:118571942-118571964
Sequence TTTCCGCTTTCCCAAATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937012073_937012074 0 Left 937012073 2:118571942-118571964 CCATGAATTTGGGAAAGCGGAAA No data
Right 937012074 2:118571965-118571987 GCTGCCAATTCACCCCAAGCAGG No data
937012073_937012078 13 Left 937012073 2:118571942-118571964 CCATGAATTTGGGAAAGCGGAAA No data
Right 937012078 2:118571978-118572000 CCCAAGCAGGCATTCCAAGCTGG No data
937012073_937012080 18 Left 937012073 2:118571942-118571964 CCATGAATTTGGGAAAGCGGAAA No data
Right 937012080 2:118571983-118572005 GCAGGCATTCCAAGCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937012073 Original CRISPR TTTCCGCTTTCCCAAATTCA TGG (reversed) Intergenic
No off target data available for this crispr