ID: 937012074

View in Genome Browser
Species Human (GRCh38)
Location 2:118571965-118571987
Sequence GCTGCCAATTCACCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937012073_937012074 0 Left 937012073 2:118571942-118571964 CCATGAATTTGGGAAAGCGGAAA No data
Right 937012074 2:118571965-118571987 GCTGCCAATTCACCCCAAGCAGG No data
937012068_937012074 30 Left 937012068 2:118571912-118571934 CCAGGCAGTTTGTACAAGAACAA No data
Right 937012074 2:118571965-118571987 GCTGCCAATTCACCCCAAGCAGG No data
937012072_937012074 1 Left 937012072 2:118571941-118571963 CCCATGAATTTGGGAAAGCGGAA No data
Right 937012074 2:118571965-118571987 GCTGCCAATTCACCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937012074 Original CRISPR GCTGCCAATTCACCCCAAGC AGG Intergenic
No off target data available for this crispr