ID: 937017412

View in Genome Browser
Species Human (GRCh38)
Location 2:118618725-118618747
Sequence CTGTGCAAAGGTAAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937017412_937017416 -10 Left 937017412 2:118618725-118618747 CCTCCTTTCTTACCTTTGCACAG No data
Right 937017416 2:118618738-118618760 CTTTGCACAGAGAGCTTGCTGGG No data
937017412_937017417 -5 Left 937017412 2:118618725-118618747 CCTCCTTTCTTACCTTTGCACAG No data
Right 937017417 2:118618743-118618765 CACAGAGAGCTTGCTGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937017412 Original CRISPR CTGTGCAAAGGTAAGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr