ID: 937018048

View in Genome Browser
Species Human (GRCh38)
Location 2:118624286-118624308
Sequence AAACCCTATTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937018048_937018050 20 Left 937018048 2:118624286-118624308 CCTATCTTTGTGAAATAGGGTTT No data
Right 937018050 2:118624329-118624351 AATGAGATTATGCAGTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937018048 Original CRISPR AAACCCTATTTCACAAAGAT AGG (reversed) Intergenic