ID: 937024214

View in Genome Browser
Species Human (GRCh38)
Location 2:118683909-118683931
Sequence GACCCTGATGTGTCTTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937024211_937024214 11 Left 937024211 2:118683875-118683897 CCCAGAGACTAGCAGTTGTCAGA No data
Right 937024214 2:118683909-118683931 GACCCTGATGTGTCTTCTTCAGG No data
937024212_937024214 10 Left 937024212 2:118683876-118683898 CCAGAGACTAGCAGTTGTCAGAT No data
Right 937024214 2:118683909-118683931 GACCCTGATGTGTCTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937024214 Original CRISPR GACCCTGATGTGTCTTCTTC AGG Intergenic
No off target data available for this crispr