ID: 937031688

View in Genome Browser
Species Human (GRCh38)
Location 2:118746048-118746070
Sequence CATGAGAGGGACACAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937031688_937031699 24 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031699 2:118746095-118746117 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
937031688_937031696 -5 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031696 2:118746066-118746088 TCATGACACGTGGGAATTATGGG 0: 8
1: 160
2: 995
3: 3282
4: 6061
937031688_937031697 20 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031697 2:118746091-118746113 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
937031688_937031695 -6 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031688_937031701 26 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031701 2:118746097-118746119 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
937031688_937031698 21 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031698 2:118746092-118746114 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
937031688_937031700 25 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031700 2:118746096-118746118 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937031688 Original CRISPR CATGAGAGGGACACAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr