ID: 937031695

View in Genome Browser
Species Human (GRCh38)
Location 2:118746065-118746087
Sequence CTCATGACACGTGGGAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10404
Summary {0: 6, 1: 172, 2: 962, 3: 3227, 4: 6037}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937031684_937031695 11 Left 937031684 2:118746031-118746053 CCCCCATGATTCAATTACCTCCC 0: 2911
1: 5949
2: 8986
3: 9650
4: 8328
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031689_937031695 -9 Left 937031689 2:118746051-118746073 CCCACTGTGTCCCTCTCATGACA No data
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031688_937031695 -6 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031686_937031695 9 Left 937031686 2:118746033-118746055 CCCATGATTCAATTACCTCCCAC 0: 2873
1: 6123
2: 9027
3: 10130
4: 8836
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031682_937031695 15 Left 937031682 2:118746027-118746049 CCCACCCCCATGATTCAATTACC 0: 480
1: 2261
2: 3041
3: 2844
4: 2154
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031683_937031695 14 Left 937031683 2:118746028-118746050 CCACCCCCATGATTCAATTACCT 0: 1142
1: 3179
2: 5066
3: 5621
4: 5204
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031685_937031695 10 Left 937031685 2:118746032-118746054 CCCCATGATTCAATTACCTCCCA 0: 2899
1: 6143
2: 9065
3: 10407
4: 10204
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031687_937031695 8 Left 937031687 2:118746034-118746056 CCATGATTCAATTACCTCCCACT 0: 1401
1: 4894
2: 7314
3: 9978
4: 10357
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037
937031690_937031695 -10 Left 937031690 2:118746052-118746074 CCACTGTGTCCCTCTCATGACAC No data
Right 937031695 2:118746065-118746087 CTCATGACACGTGGGAATTATGG 0: 6
1: 172
2: 962
3: 3227
4: 6037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937031695 Original CRISPR CTCATGACACGTGGGAATTA TGG Intergenic
Too many off-targets to display for this crispr