ID: 937031697

View in Genome Browser
Species Human (GRCh38)
Location 2:118746091-118746113
Sequence CTACAATTCAAGATGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38431
Summary {0: 4048, 1: 7216, 2: 8939, 3: 8984, 4: 9244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937031694_937031697 6 Left 937031694 2:118746062-118746084 CCTCTCATGACACGTGGGAATTA 0: 6
1: 161
2: 1063
3: 3568
4: 7323
Right 937031697 2:118746091-118746113 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
937031690_937031697 16 Left 937031690 2:118746052-118746074 CCACTGTGTCCCTCTCATGACAC No data
Right 937031697 2:118746091-118746113 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
937031688_937031697 20 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031697 2:118746091-118746113 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
937031693_937031697 7 Left 937031693 2:118746061-118746083 CCCTCTCATGACACGTGGGAATT 0: 8
1: 191
2: 1101
3: 3823
4: 7719
Right 937031697 2:118746091-118746113 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
937031689_937031697 17 Left 937031689 2:118746051-118746073 CCCACTGTGTCCCTCTCATGACA No data
Right 937031697 2:118746091-118746113 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937031697 Original CRISPR CTACAATTCAAGATGAGATT TGG Intergenic
Too many off-targets to display for this crispr