ID: 937031698

View in Genome Browser
Species Human (GRCh38)
Location 2:118746092-118746114
Sequence TACAATTCAAGATGAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39211
Summary {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937031693_937031698 8 Left 937031693 2:118746061-118746083 CCCTCTCATGACACGTGGGAATT 0: 8
1: 191
2: 1101
3: 3823
4: 7719
Right 937031698 2:118746092-118746114 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
937031694_937031698 7 Left 937031694 2:118746062-118746084 CCTCTCATGACACGTGGGAATTA 0: 6
1: 161
2: 1063
3: 3568
4: 7323
Right 937031698 2:118746092-118746114 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
937031690_937031698 17 Left 937031690 2:118746052-118746074 CCACTGTGTCCCTCTCATGACAC No data
Right 937031698 2:118746092-118746114 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
937031689_937031698 18 Left 937031689 2:118746051-118746073 CCCACTGTGTCCCTCTCATGACA No data
Right 937031698 2:118746092-118746114 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
937031688_937031698 21 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031698 2:118746092-118746114 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937031698 Original CRISPR TACAATTCAAGATGAGATTT GGG Intergenic
Too many off-targets to display for this crispr