ID: 937031699

View in Genome Browser
Species Human (GRCh38)
Location 2:118746095-118746117
Sequence AATTCAAGATGAGATTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43710
Summary {0: 7468, 1: 11239, 2: 9760, 3: 8452, 4: 6791}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937031688_937031699 24 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031699 2:118746095-118746117 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
937031693_937031699 11 Left 937031693 2:118746061-118746083 CCCTCTCATGACACGTGGGAATT 0: 8
1: 191
2: 1101
3: 3823
4: 7719
Right 937031699 2:118746095-118746117 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
937031689_937031699 21 Left 937031689 2:118746051-118746073 CCCACTGTGTCCCTCTCATGACA No data
Right 937031699 2:118746095-118746117 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
937031694_937031699 10 Left 937031694 2:118746062-118746084 CCTCTCATGACACGTGGGAATTA 0: 6
1: 161
2: 1063
3: 3568
4: 7323
Right 937031699 2:118746095-118746117 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
937031690_937031699 20 Left 937031690 2:118746052-118746074 CCACTGTGTCCCTCTCATGACAC No data
Right 937031699 2:118746095-118746117 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937031699 Original CRISPR AATTCAAGATGAGATTTGGG TGG Intergenic
Too many off-targets to display for this crispr