ID: 937031700

View in Genome Browser
Species Human (GRCh38)
Location 2:118746096-118746118
Sequence ATTCAAGATGAGATTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42911
Summary {0: 7461, 1: 10942, 2: 10318, 3: 7687, 4: 6503}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937031689_937031700 22 Left 937031689 2:118746051-118746073 CCCACTGTGTCCCTCTCATGACA No data
Right 937031700 2:118746096-118746118 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
937031690_937031700 21 Left 937031690 2:118746052-118746074 CCACTGTGTCCCTCTCATGACAC No data
Right 937031700 2:118746096-118746118 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
937031688_937031700 25 Left 937031688 2:118746048-118746070 CCTCCCACTGTGTCCCTCTCATG No data
Right 937031700 2:118746096-118746118 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
937031693_937031700 12 Left 937031693 2:118746061-118746083 CCCTCTCATGACACGTGGGAATT 0: 8
1: 191
2: 1101
3: 3823
4: 7719
Right 937031700 2:118746096-118746118 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
937031694_937031700 11 Left 937031694 2:118746062-118746084 CCTCTCATGACACGTGGGAATTA 0: 6
1: 161
2: 1063
3: 3568
4: 7323
Right 937031700 2:118746096-118746118 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937031700 Original CRISPR ATTCAAGATGAGATTTGGGT GGG Intergenic
Too many off-targets to display for this crispr