ID: 937031943

View in Genome Browser
Species Human (GRCh38)
Location 2:118747957-118747979
Sequence CTGTGTGACCAAAACTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937031940_937031943 -1 Left 937031940 2:118747935-118747957 CCTGGAAGCAGGTGGGGAAGTGC No data
Right 937031943 2:118747957-118747979 CTGTGTGACCAAAACTGGGTTGG No data
937031931_937031943 30 Left 937031931 2:118747904-118747926 CCATGAATCTATTTGTATCTGCC No data
Right 937031943 2:118747957-118747979 CTGTGTGACCAAAACTGGGTTGG No data
937031939_937031943 0 Left 937031939 2:118747934-118747956 CCCTGGAAGCAGGTGGGGAAGTG No data
Right 937031943 2:118747957-118747979 CTGTGTGACCAAAACTGGGTTGG No data
937031936_937031943 6 Left 937031936 2:118747928-118747950 CCTTCTCCCTGGAAGCAGGTGGG No data
Right 937031943 2:118747957-118747979 CTGTGTGACCAAAACTGGGTTGG No data
937031934_937031943 9 Left 937031934 2:118747925-118747947 CCTCCTTCTCCCTGGAAGCAGGT No data
Right 937031943 2:118747957-118747979 CTGTGTGACCAAAACTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937031943 Original CRISPR CTGTGTGACCAAAACTGGGT TGG Intergenic
No off target data available for this crispr