ID: 937032207

View in Genome Browser
Species Human (GRCh38)
Location 2:118750133-118750155
Sequence GTGTGCTAATGGAAGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937032207_937032211 1 Left 937032207 2:118750133-118750155 CCTGAACTCTTCCATTAGCACAC No data
Right 937032211 2:118750157-118750179 ATATTTTAAAACACATGACGGGG No data
937032207_937032210 0 Left 937032207 2:118750133-118750155 CCTGAACTCTTCCATTAGCACAC No data
Right 937032210 2:118750156-118750178 TATATTTTAAAACACATGACGGG No data
937032207_937032212 11 Left 937032207 2:118750133-118750155 CCTGAACTCTTCCATTAGCACAC No data
Right 937032212 2:118750167-118750189 ACACATGACGGGGTCAGAACAGG No data
937032207_937032209 -1 Left 937032207 2:118750133-118750155 CCTGAACTCTTCCATTAGCACAC No data
Right 937032209 2:118750155-118750177 CTATATTTTAAAACACATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937032207 Original CRISPR GTGTGCTAATGGAAGAGTTC AGG (reversed) Intergenic
No off target data available for this crispr