ID: 937036497

View in Genome Browser
Species Human (GRCh38)
Location 2:118786659-118786681
Sequence AGAGAGAAGCCCAGTGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937036497_937036507 21 Left 937036497 2:118786659-118786681 CCGTCCCCACTGGGCTTCTCTCT No data
Right 937036507 2:118786703-118786725 TGCCCTGGCTGGAGATGCACAGG No data
937036497_937036506 10 Left 937036497 2:118786659-118786681 CCGTCCCCACTGGGCTTCTCTCT No data
Right 937036506 2:118786692-118786714 CACATCAGCATTGCCCTGGCTGG No data
937036497_937036504 6 Left 937036497 2:118786659-118786681 CCGTCCCCACTGGGCTTCTCTCT No data
Right 937036504 2:118786688-118786710 CCTCCACATCAGCATTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937036497 Original CRISPR AGAGAGAAGCCCAGTGGGGA CGG (reversed) Intergenic
No off target data available for this crispr