ID: 937037419

View in Genome Browser
Species Human (GRCh38)
Location 2:118793537-118793559
Sequence GGCCACTGTAACCCTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937037419_937037425 18 Left 937037419 2:118793537-118793559 CCATGGCCAGGGTTACAGTGGCC No data
Right 937037425 2:118793578-118793600 ATCCCTCCAAGAGCACTCTTTGG No data
937037419_937037422 -5 Left 937037419 2:118793537-118793559 CCATGGCCAGGGTTACAGTGGCC No data
Right 937037422 2:118793555-118793577 TGGCCTCATGAGACAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937037419 Original CRISPR GGCCACTGTAACCCTGGCCA TGG (reversed) Intergenic
No off target data available for this crispr