ID: 937040482

View in Genome Browser
Species Human (GRCh38)
Location 2:118816774-118816796
Sequence TTGTAGACACTGTTGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937040476_937040482 22 Left 937040476 2:118816729-118816751 CCCAAGATCATTCAAAAACATGG No data
Right 937040482 2:118816774-118816796 TTGTAGACACTGTTGTGCCTGGG No data
937040478_937040482 21 Left 937040478 2:118816730-118816752 CCAAGATCATTCAAAAACATGGA No data
Right 937040482 2:118816774-118816796 TTGTAGACACTGTTGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937040482 Original CRISPR TTGTAGACACTGTTGTGCCT GGG Intergenic
No off target data available for this crispr