ID: 937042996

View in Genome Browser
Species Human (GRCh38)
Location 2:118835626-118835648
Sequence CCGGGTGCACCCCGCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937042990_937042996 -4 Left 937042990 2:118835607-118835629 CCGGGAGCCGAAGGGACGCCCGG No data
Right 937042996 2:118835626-118835648 CCGGGTGCACCCCGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937042996 Original CRISPR CCGGGTGCACCCCGCTGCAG AGG Intergenic
No off target data available for this crispr