ID: 937044236

View in Genome Browser
Species Human (GRCh38)
Location 2:118842860-118842882
Sequence TTCTCCCCCAGCGAGGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937044229_937044236 -3 Left 937044229 2:118842840-118842862 CCCTCCTTGGAGCAGATGCTTTC 0: 1
1: 0
2: 3
3: 16
4: 184
Right 937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 187
937044227_937044236 1 Left 937044227 2:118842836-118842858 CCCTCCCTCCTTGGAGCAGATGC 0: 1
1: 0
2: 4
3: 20
4: 294
Right 937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 187
937044224_937044236 10 Left 937044224 2:118842827-118842849 CCCTGCGCTCCCTCCCTCCTTGG 0: 1
1: 0
2: 1
3: 46
4: 601
Right 937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 187
937044226_937044236 9 Left 937044226 2:118842828-118842850 CCTGCGCTCCCTCCCTCCTTGGA 0: 1
1: 0
2: 1
3: 48
4: 491
Right 937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 187
937044228_937044236 0 Left 937044228 2:118842837-118842859 CCTCCCTCCTTGGAGCAGATGCT 0: 1
1: 1
2: 2
3: 22
4: 269
Right 937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 187
937044231_937044236 -7 Left 937044231 2:118842844-118842866 CCTTGGAGCAGATGCTTTCTCCC 0: 1
1: 0
2: 0
3: 17
4: 212
Right 937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 187
937044230_937044236 -4 Left 937044230 2:118842841-118842863 CCTCCTTGGAGCAGATGCTTTCT 0: 1
1: 0
2: 1
3: 27
4: 170
Right 937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937044236 Original CRISPR TTCTCCCCCAGCGAGGGGCC GGG Exonic
900072100 1:779111-779133 GCCTCCCCCAGCCAGGGCCCGGG + Intergenic
900139886 1:1135181-1135203 TCCCTCCCCAGGGAGGGGCCTGG + Intergenic
900463471 1:2812423-2812445 TTCTCCTGCAGCCTGGGGCCTGG - Intergenic
900486282 1:2924298-2924320 TTCCCACCCAGGGATGGGCCCGG + Intergenic
900949898 1:5852768-5852790 GTCTCCCCTAGCCAGGTGCCCGG + Intergenic
900989887 1:6093646-6093668 TGCTCCTCCTGTGAGGGGCCAGG - Intronic
905141172 1:35846057-35846079 TCCTCCCCCAGGCAGGGGCATGG + Intronic
905415308 1:37799889-37799911 TTCATCCCCAGTGTGGGGCCTGG + Exonic
905632701 1:39527499-39527521 TGCACCCCCAGGGAGGGGCCTGG + Intergenic
905665115 1:39758918-39758940 TGCACCCCCAGGGAGGGGCCTGG - Exonic
905773598 1:40654049-40654071 GTCTCCCCCAGCGAGGGTGTGGG - Intronic
906307227 1:44727029-44727051 TTCTCCCAGGGGGAGGGGCCTGG + Intergenic
906315999 1:44786763-44786785 ACCTCCCCCAGCAAAGGGCCTGG + Intronic
907661249 1:56394518-56394540 TTCTCCACCAGCCAGGCTCCTGG + Intergenic
908038357 1:60080702-60080724 TTATCCCCCAGCATGTGGCCTGG - Intergenic
912352206 1:109025139-109025161 TTCTCCCTCAGCTAGAGGCCTGG + Intronic
915528334 1:156489611-156489633 TATTCCCCCAGCGCTGGGCCAGG - Intronic
915561630 1:156691442-156691464 TTCCTCACCAGCGAGGGGCCTGG - Intergenic
916496714 1:165354239-165354261 TTCTCCCCTTCCGAGAGGCCCGG + Intronic
917276669 1:173338613-173338635 TTCTCCCATAGCTAGGGTCCGGG + Intergenic
920965065 1:210694535-210694557 TTCTTCCCCACCTAGGGGACAGG - Intronic
922267036 1:223993066-223993088 GCCTCCCCCAGCCAGGGCCCGGG + Intergenic
922609351 1:226912949-226912971 TTCTCTCCCTCCCAGGGGCCAGG + Intronic
922784759 1:228277373-228277395 GTGTCCCCCAGCCAGGGGCTTGG + Intronic
1067792696 10:49299828-49299850 AGCTCCCCCAGCGCTGGGCCAGG + Intronic
1069756434 10:70776753-70776775 TCCACACTCAGCGAGGGGCCTGG - Intronic
1069827389 10:71262479-71262501 TTCTCCCCAAGGAAGTGGCCTGG - Intronic
1070818347 10:79339486-79339508 TTCCCCACCAGGGAAGGGCCTGG + Intergenic
1072811836 10:98468057-98468079 TCCTCGCTCAGCGAGGGGGCCGG - Intronic
1073121863 10:101126814-101126836 TCCTCCCCCAGCCCGGGCCCTGG + Intronic
1075521439 10:123146040-123146062 TTCTTCCCCAGCGGGGTGGCTGG + Intergenic
1075727502 10:124618092-124618114 TTCTGCCCCCACGTGGGGCCTGG - Exonic
1077029723 11:459594-459616 TTTTCCACCAGCGATGGGACAGG + Intronic
1077153902 11:1083152-1083174 TTGCGCCCCAGGGAGGGGCCCGG + Intergenic
1077194499 11:1272414-1272436 TCATCCCCCAGCGAGGGCCTGGG + Intergenic
1077630612 11:3808731-3808753 GACTCCCACAGCGTGGGGCCCGG - Intronic
1077630635 11:3808836-3808858 TCCCTCCCCAGCGTGGGGCCGGG + Intronic
1079130054 11:17741947-17741969 TTCTCTCCCAGGAAGGGCCCTGG - Intronic
1079839912 11:25383318-25383340 TTCTCCCACAGTGAGGATCCCGG + Intergenic
1080459342 11:32439426-32439448 TTCACCGCCAGCGCGGGGCTGGG - Intergenic
1080643953 11:34174688-34174710 CTCCCCGCCACCGAGGGGCCCGG + Intronic
1082283640 11:50298139-50298161 ACCTCCCCCAGCCAGGGCCCGGG - Intergenic
1084192830 11:67506610-67506632 TTCTCCCCCAGCAGGGGCACAGG - Exonic
1084425892 11:69084481-69084503 CTGGCCCCCAGGGAGGGGCCGGG - Intronic
1085773280 11:79343160-79343182 TTCTCCCTCTTCCAGGGGCCAGG - Intronic
1086563098 11:88191886-88191908 TTCTACCCCCACAAGGGGCCGGG + Intergenic
1090432465 11:126657552-126657574 TTCTCACCCAGTGTGGGGCTGGG + Intronic
1090993003 11:131837762-131837784 GGCTCCCCCAGCGTGGGGCCTGG - Intronic
1092603965 12:10099028-10099050 TTCTTTCCCAGCGAGGGGCAGGG + Intronic
1100518298 12:95349575-95349597 TTCTCCTGCAGCTAGGGCCCAGG - Intergenic
1102826771 12:115953352-115953374 TTATCCCCTAGCTTGGGGCCTGG + Intergenic
1104690188 12:130819385-130819407 CTCTCTCCCAGTGATGGGCCCGG - Intronic
1105704020 13:22957759-22957781 TTCTACCCCAGGGCTGGGCCTGG - Intergenic
1105856973 13:24382843-24382865 TTCTACCCCAGGGCTGGGCCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108493116 13:51000622-51000644 GTCGCCTCCAGAGAGGGGCCTGG + Intergenic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1114193552 14:20458514-20458536 GTCCCCACCAGGGAGGGGCCAGG + Exonic
1121115816 14:91341849-91341871 AGGCCCCCCAGCGAGGGGCCGGG - Intronic
1122601641 14:102924478-102924500 CACTGCGCCAGCGAGGGGCCTGG + Intronic
1122845731 14:104497089-104497111 TTCTACCCCAGGGCTGGGCCTGG - Intronic
1122866400 14:104606545-104606567 TTCTCAGCCAGCGAGGGGAGGGG - Intergenic
1122980562 14:105190744-105190766 TTCTCACCCAGGGAGGCCCCTGG - Intergenic
1123574921 15:21656666-21656688 CTCTCCACCAGGGAGGGCCCTGG + Intergenic
1123611536 15:22099155-22099177 CTCTCCACCAGGGAGGGCCCTGG + Intergenic
1126735992 15:51732694-51732716 CTCTCCCCTAGAGATGGGCCTGG - Intronic
1131067739 15:89444692-89444714 TCCTACCCCAGGAAGGGGCCTGG - Intergenic
1202983789 15_KI270727v1_random:390910-390932 CTCTCCACCAGGGAGGGCCCTGG + Intergenic
1132510339 16:337775-337797 TTCTCCTCCAGCAAGGACCCTGG - Intronic
1132614053 16:831678-831700 TTCTGGCCCAGCGAGGCACCTGG + Intergenic
1134682072 16:16133209-16133231 TTGTCCCCCAGCAAATGGCCAGG - Intronic
1135929429 16:26724286-26724308 TGCTCCCCCAGGAAGGGGGCTGG + Intergenic
1135985163 16:27178753-27178775 TTCCTCCCCAGGGAGGTGCCAGG + Intergenic
1136139371 16:28278804-28278826 TTTGTCCCCAGCCAGGGGCCTGG + Intergenic
1136192186 16:28623118-28623140 TTCTACGCCGGTGAGGGGCCGGG - Exonic
1138594241 16:58021244-58021266 CTCACCCCCAGCAAGGTGCCTGG + Exonic
1140476955 16:75243887-75243909 TGCTGCCCCATCGAGGTGCCAGG + Intronic
1141175100 16:81713555-81713577 TTCTCCACCGGCGTAGGGCCTGG + Intergenic
1141201308 16:81900538-81900560 ATCTGCCCCACAGAGGGGCCAGG - Intronic
1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG + Intronic
1144851491 17:18246289-18246311 TCCTCCCCCAGCCAGGCACCGGG + Exonic
1145063152 17:19744833-19744855 GTCTCCGCGACCGAGGGGCCAGG + Intronic
1147157756 17:38552772-38552794 TTCTCCTCCAGCTCAGGGCCGGG + Exonic
1147316784 17:39624874-39624896 ATCTCCCCCAGCCTGTGGCCAGG - Intergenic
1150018081 17:61580223-61580245 TCTTCCCCAAGCGAGAGGCCTGG - Intergenic
1151849690 17:76683052-76683074 TTCACCCCCAGCCGGAGGCCTGG + Intronic
1154980324 18:21498332-21498354 TGCTCCCCCAGCCAGGGGTTAGG + Intronic
1159956770 18:74524200-74524222 GTGTCCCCCAGCGAGGGGAGGGG - Intergenic
1160358323 18:78247238-78247260 GTCTCCCACTGCGAGGGCCCCGG - Intergenic
1161975869 19:7607570-7607592 CTCTCCCCAAGCTGGGGGCCTGG + Intronic
1165773154 19:38389805-38389827 TTCTCACCCAGCCTGTGGCCTGG + Intronic
1166045997 19:40231646-40231668 ACCTCCCCCAGCAAGGGACCAGG - Exonic
1166230890 19:41425431-41425453 GCCTCCCCCAGCCAGGGGCCTGG - Exonic
1167818379 19:51904425-51904447 CTCAACCCCAGCCAGGGGCCTGG + Intronic
925180320 2:1813309-1813331 TTCTCCCTCAGCGAGGCCCCTGG + Intronic
927211115 2:20639780-20639802 CTCTCCACCAGAGAGGGGCTGGG + Intronic
929508331 2:42546306-42546328 TTCTTCCTCAGTGTGGGGCCAGG - Intronic
934187902 2:89763042-89763064 CTCTCCCCCACGGAGGGGCTTGG + Intergenic
936428167 2:112436641-112436663 TTCCCACCCTGAGAGGGGCCTGG - Intergenic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
937228748 2:120384685-120384707 GACTCCCCCATCCAGGGGCCTGG - Intergenic
938771782 2:134506945-134506967 TTCTCCCCCAGAGTTGGGGCAGG - Intronic
943151266 2:184116423-184116445 TTCTGCACCTGCAAGGGGCCTGG - Intergenic
945895277 2:215474293-215474315 TTCTACCCCAGAGAGGGAGCTGG + Intergenic
947049967 2:226031148-226031170 TTCTCAGACAGCGAGGGCCCAGG - Intergenic
948192675 2:236071998-236072020 TTCTCTCCTAGAGATGGGCCAGG - Intronic
948206653 2:236166269-236166291 GTCTCCTCCAGCGCGTGGCCCGG + Exonic
948471446 2:238183160-238183182 TTCTCCCTCAGCCAGGGACCGGG + Intronic
948632147 2:239309187-239309209 TTCTTCCCCAGCGAGGCCGCCGG - Intronic
1174402225 20:50282253-50282275 GTGTCCCCCAGCCAGGGGGCGGG + Intergenic
1175517416 20:59578065-59578087 TTCTTCCCCAGGGAGGGCCATGG + Intronic
1176100955 20:63364320-63364342 CTCTCCCGGAGCCAGGGGCCAGG + Intronic
1176374085 21:6078570-6078592 TTCCCACCCTGAGAGGGGCCTGG + Intergenic
1179125059 21:38583232-38583254 CTCTGCCCCAGTCAGGGGCCTGG - Intronic
1179727929 21:43350630-43350652 TTCCATCCCAGCGAGGGACCAGG - Intergenic
1179749392 21:43459673-43459695 TTCCCACCCTGAGAGGGGCCTGG - Intergenic
1181310476 22:21942021-21942043 TTCTCACCCAGTGGGGGCCCTGG + Intronic
1182354564 22:29716739-29716761 TTCTCCCCCAGCAGGAGCCCTGG + Intergenic
1183833993 22:40436936-40436958 TCCACCCCCAGCGGGGGGCTGGG + Intronic
1183965462 22:41439140-41439162 TTCTCCCCCAGCATGAGCCCCGG - Intronic
1184688307 22:46106244-46106266 GTCTCCCTCAGTGATGGGCCTGG - Intronic
1184775732 22:46621775-46621797 TTCACCACCAGGGATGGGCCCGG - Intronic
1185029152 22:48432492-48432514 TTCTCCTCCTGGGAAGGGCCAGG - Intergenic
1185049413 22:48546012-48546034 CTCCCGCCCAGCGACGGGCCTGG - Intronic
1185103205 22:48852729-48852751 TTCTGCCCCAGGCAGGGGACAGG - Intergenic
1185272215 22:49934832-49934854 CTCTGCACCAGTGAGGGGCCGGG + Intergenic
950522503 3:13505339-13505361 TTCACCCCCACAGAAGGGCCTGG - Exonic
952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG + Intronic
953168044 3:40482660-40482682 CTCTCCCCCAGCAAGTGTCCAGG - Exonic
954575639 3:51674582-51674604 TTCTGCCCCATGGATGGGCCTGG + Intronic
956833396 3:73075454-73075476 TTGTCCCCCACAGAGGGGCTCGG + Intergenic
961456928 3:127028982-127029004 TCCTCCCCCAGAGTGGCGCCAGG + Exonic
962809566 3:138949111-138949133 TCCTCCCCCAGCCAGGGCCTGGG + Intronic
963018194 3:140845642-140845664 TTATTTCCCAGCGTGGGGCCAGG - Intergenic
963814397 3:149813296-149813318 TTCTCCCGCAGCGACGCGGCTGG + Exonic
966919852 3:184604322-184604344 TTCTCGCCCAGCCAGGGCTCGGG - Intronic
966974649 3:185073368-185073390 TTCTGCCCCAGCTAGGGGTGTGG + Intergenic
968660877 4:1798235-1798257 TCAGCCCCCAGGGAGGGGCCAGG + Intronic
974302720 4:60089702-60089724 CTCTCCTTCAGTGAGGGGCCTGG - Intergenic
974556278 4:63452730-63452752 TTCTCCCAGAGAGAGGGGTCTGG - Intergenic
974854658 4:67446035-67446057 CTCTCGCCCAGCGAGGGGAAAGG - Intergenic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
978539300 4:109799431-109799453 TTCTCACTCAGGGAGGGACCCGG - Intronic
981103460 4:140855417-140855439 TTCTCTCCCAGCCTGGGGCTTGG + Intergenic
985708988 5:1417691-1417713 TTCTCCCCCATCCAAGGCCCAGG - Intronic
986254155 5:6087902-6087924 CTCTGCCCCAGTGAGGGGCAGGG - Intergenic
990044136 5:51408225-51408247 TTATCACCTAGCCAGGGGCCTGG - Intergenic
990450495 5:55928270-55928292 TCCTCCCCAGGCAAGGGGCCTGG + Intergenic
991003368 5:61804899-61804921 TTCTCCCCCATGAAGAGGCCAGG + Intergenic
997400197 5:133596260-133596282 TTCAGCCCCAGCCAGGGGCCTGG - Intronic
998882152 5:146655338-146655360 TTCCCCCCCAGAGAGTGGCACGG + Intronic
1002091729 5:176810314-176810336 GGCTCCCCCAGGGAGGGGCTTGG - Intergenic
1003001182 6:2335206-2335228 ATCTCCCCAAGCCAGGGGCTTGG - Intergenic
1004044278 6:12011301-12011323 TTCTGCCCGGGCGAGGGGCGGGG + Intronic
1006378149 6:33683196-33683218 TTCCCACCCAGCCAAGGGCCGGG + Exonic
1006633046 6:35443056-35443078 TTGACCCCCAGCGATGGGCCCGG - Intergenic
1011166952 6:84459184-84459206 TTCTCCCCTTCAGAGGGGCCAGG + Intergenic
1014230136 6:118894124-118894146 TCCTCCTCCAGCGAGGGCCTCGG - Intronic
1014774941 6:125497741-125497763 TTCTCCCACAGTGAGGAGCCTGG + Intergenic
1021041565 7:15869289-15869311 TTCTCCCGCAGGGAGGAGGCAGG + Intergenic
1021706109 7:23369417-23369439 GTCTCCCCCAGCTGGGGGCTGGG - Intronic
1022687239 7:32608566-32608588 TTCTCCAGCAGCCTGGGGCCAGG - Intergenic
1025990616 7:66494040-66494062 TCCTCCCCCAGCCAGGTCCCGGG + Intergenic
1026804975 7:73423947-73423969 GCCTCCCCCAGGCAGGGGCCGGG + Intergenic
1027213274 7:76167033-76167055 TCCTCCCCCAGCCAGGTCCCGGG + Intergenic
1028622189 7:92836657-92836679 TCCGCCCCCAGCGAGCGGCGCGG - Intergenic
1029459132 7:100685392-100685414 TTGTCCCCCAGAGTGGGCCCAGG + Exonic
1034601547 7:152262143-152262165 TCCTCCCCCAGCTGGGGACCTGG + Intronic
1035278068 7:157759851-157759873 TCCTCCCCAAGAGAGGGGCAGGG - Intronic
1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG + Intronic
1035636095 8:1145380-1145402 CACTCGCCCAGCGTGGGGCCTGG + Intergenic
1036651538 8:10647060-10647082 TGCTGCCCCAGCCTGGGGCCCGG - Intronic
1037813910 8:22102097-22102119 CACTCCCCCAGCAAGGTGCCTGG - Intronic
1037987938 8:23301307-23301329 TTCTCCCCCAGTTAGAGCCCTGG + Intronic
1039277607 8:35950936-35950958 GTCTCCCCCAGCAGGGGCCCAGG + Intergenic
1039412160 8:37364085-37364107 TTCTCCCCCAGCAAAGGGAAAGG - Intergenic
1039560973 8:38512322-38512344 TCCTCCGCGAGGGAGGGGCCGGG + Exonic
1041773661 8:61499741-61499763 TTTTCCCCCAGTGAGGGGACTGG + Exonic
1042020806 8:64370265-64370287 TGAGCCCCCAGCGAGGGGCGTGG + Intergenic
1042737005 8:72000935-72000957 CTCTCCCCCAGTGATGGGCAAGG + Intronic
1045288139 8:100809818-100809840 TACTACGACAGCGAGGGGCCCGG + Intergenic
1045381940 8:101635956-101635978 TTCTCACCCAGGCAGGGGCAGGG + Intronic
1048857748 8:138698510-138698532 TGCTCTCCCAGAGAGGGGCTTGG - Intronic
1049049824 8:140185677-140185699 GCCTCCACCAGCGAGGGGCGGGG + Intronic
1049433254 8:142574945-142574967 TTCTCTCCCAGCGAGGCCCCAGG + Intergenic
1049765136 8:144351709-144351731 TCCTGCCCCAGAGATGGGCCAGG + Intergenic
1051355944 9:16239900-16239922 CTCACCCCCAGCCAGGGCCCAGG + Intronic
1055084401 9:72299431-72299453 TTCTCCCCACTGGAGGGGCCTGG + Intergenic
1060203505 9:121667370-121667392 TGCTCCCCGAGGGAGGGGCCAGG - Intronic
1060831997 9:126722829-126722851 TTCCTCCCCAGGGCGGGGCCCGG + Intergenic
1061049485 9:128185984-128186006 TTCTGCCCCAGCTAGGGGTGGGG + Intronic
1061102653 9:128503990-128504012 TACATCCCCAGCGAGGGGTCAGG + Intergenic
1061923703 9:133795791-133795813 TCCTGCCCCAGGTAGGGGCCAGG - Intronic
1062261941 9:135667241-135667263 TTCTCCCCCGGGCAGGGGGCAGG - Intergenic
1062262476 9:135669872-135669894 TTCTACTCCAGCCAGGAGCCAGG - Intergenic
1062296195 9:135828465-135828487 CTCTCCTACAGCCAGGGGCCAGG + Intronic
1062366869 9:136214355-136214377 TCCTCCCCTTGCGAGTGGCCTGG + Intronic
1062471991 9:136710182-136710204 CTCTCTGCCAGCGAGGGTCCCGG - Intergenic
1189177398 X:38971669-38971691 TTCTCTCTCAGTGAGGGGCTTGG - Intergenic
1192502949 X:71665284-71665306 TCCTCCCCCAGAGAGGAGCTGGG - Intergenic
1192724097 X:73729353-73729375 TTCTCTGCCAGCCAGTGGCCAGG + Intergenic
1195347363 X:103963368-103963390 TACTCCACCAGGGTGGGGCCGGG + Exonic
1195360079 X:104075473-104075495 TACTCCACCAGGGTGGGGCCGGG - Intergenic