ID: 937046090

View in Genome Browser
Species Human (GRCh38)
Location 2:118852793-118852815
Sequence GCGCCCTCTGCGCCCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046090_937046096 12 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046090_937046101 24 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data
937046090_937046100 21 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046090_937046098 13 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046090 Original CRISPR GCGCCCTCTGCGCCCGGCGC GGG (reversed) Intergenic