ID: 937046091

View in Genome Browser
Species Human (GRCh38)
Location 2:118852794-118852816
Sequence GGCGCCCTCTGCGCCCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046091_937046096 11 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046091_937046101 23 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data
937046091_937046098 12 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046091_937046100 20 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046091_937046103 30 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046103 2:118852847-118852869 GCGGGTTTGCAGGCGGCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046091 Original CRISPR GGCGCCCTCTGCGCCCGGCG CGG (reversed) Intergenic