ID: 937046094

View in Genome Browser
Species Human (GRCh38)
Location 2:118852799-118852821
Sequence ACCCTGGCGCCCTCTGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046094_937046098 7 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046094_937046104 26 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046104 2:118852848-118852870 CGGGTTTGCAGGCGGCCTTCGGG No data
937046094_937046100 15 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046094_937046103 25 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046103 2:118852847-118852869 GCGGGTTTGCAGGCGGCCTTCGG No data
937046094_937046096 6 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046094_937046101 18 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046094 Original CRISPR ACCCTGGCGCCCTCTGCGCC CGG (reversed) Intergenic