ID: 937046095

View in Genome Browser
Species Human (GRCh38)
Location 2:118852815-118852837
Sequence CAGTTCGGGTGTTTGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046095_937046103 9 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046103 2:118852847-118852869 GCGGGTTTGCAGGCGGCCTTCGG No data
937046095_937046105 18 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046105 2:118852856-118852878 CAGGCGGCCTTCGGGCTGCGCGG No data
937046095_937046101 2 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data
937046095_937046096 -10 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046095_937046107 20 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046107 2:118852858-118852880 GGCGGCCTTCGGGCTGCGCGGGG No data
937046095_937046100 -1 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046095_937046106 19 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046106 2:118852857-118852879 AGGCGGCCTTCGGGCTGCGCGGG No data
937046095_937046104 10 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046104 2:118852848-118852870 CGGGTTTGCAGGCGGCCTTCGGG No data
937046095_937046098 -9 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046095_937046110 29 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046110 2:118852867-118852889 CGGGCTGCGCGGGGATGTCCGGG No data
937046095_937046109 28 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046109 2:118852866-118852888 TCGGGCTGCGCGGGGATGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046095 Original CRISPR CAGTTCGGGTGTTTGCACCC TGG (reversed) Intergenic