ID: 937046096

View in Genome Browser
Species Human (GRCh38)
Location 2:118852828-118852850
Sequence ACCCGAACTGTCGCCGCTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046083_937046096 30 Left 937046083 2:118852775-118852797 CCGCCGGCTGTCCACAGGCCCGC No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046094_937046096 6 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046087_937046096 19 Left 937046087 2:118852786-118852808 CCACAGGCCCGCGCCGGGCGCAG No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046091_937046096 11 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046095_937046096 -10 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046090_937046096 12 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data
937046084_937046096 27 Left 937046084 2:118852778-118852800 CCGGCTGTCCACAGGCCCGCGCC No data
Right 937046096 2:118852828-118852850 ACCCGAACTGTCGCCGCTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046096 Original CRISPR ACCCGAACTGTCGCCGCTCG CGG Intergenic