ID: 937046098

View in Genome Browser
Species Human (GRCh38)
Location 2:118852829-118852851
Sequence CCCGAACTGTCGCCGCTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046094_937046098 7 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046095_937046098 -9 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046087_937046098 20 Left 937046087 2:118852786-118852808 CCACAGGCCCGCGCCGGGCGCAG No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046084_937046098 28 Left 937046084 2:118852778-118852800 CCGGCTGTCCACAGGCCCGCGCC No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046090_937046098 13 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
937046091_937046098 12 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046098 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046098 Original CRISPR CCCGAACTGTCGCCGCTCGC GGG Intergenic