ID: 937046099

View in Genome Browser
Species Human (GRCh38)
Location 2:118852830-118852852
Sequence ACCCGCGAGCGGCGACAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046099_937046110 14 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046110 2:118852867-118852889 CGGGCTGCGCGGGGATGTCCGGG No data
937046099_937046112 28 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046112 2:118852881-118852903 ATGTCCGGGAGCCCGACGCAGGG No data
937046099_937046105 3 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046105 2:118852856-118852878 CAGGCGGCCTTCGGGCTGCGCGG No data
937046099_937046109 13 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046109 2:118852866-118852888 TCGGGCTGCGCGGGGATGTCCGG No data
937046099_937046104 -5 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046104 2:118852848-118852870 CGGGTTTGCAGGCGGCCTTCGGG No data
937046099_937046111 27 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046111 2:118852880-118852902 GATGTCCGGGAGCCCGACGCAGG No data
937046099_937046107 5 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046107 2:118852858-118852880 GGCGGCCTTCGGGCTGCGCGGGG No data
937046099_937046103 -6 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046103 2:118852847-118852869 GCGGGTTTGCAGGCGGCCTTCGG No data
937046099_937046106 4 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046106 2:118852857-118852879 AGGCGGCCTTCGGGCTGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046099 Original CRISPR ACCCGCGAGCGGCGACAGTT CGG (reversed) Intergenic