ID: 937046100

View in Genome Browser
Species Human (GRCh38)
Location 2:118852837-118852859
Sequence GTCGCCGCTCGCGGGTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046095_937046100 -1 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046094_937046100 15 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046090_937046100 21 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046091_937046100 20 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data
937046087_937046100 28 Left 937046087 2:118852786-118852808 CCACAGGCCCGCGCCGGGCGCAG No data
Right 937046100 2:118852837-118852859 GTCGCCGCTCGCGGGTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046100 Original CRISPR GTCGCCGCTCGCGGGTTTGC AGG Intergenic