ID: 937046101

View in Genome Browser
Species Human (GRCh38)
Location 2:118852840-118852862
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046091_937046101 23 Left 937046091 2:118852794-118852816 CCGCGCCGGGCGCAGAGGGCGCC No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data
937046094_937046101 18 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data
937046090_937046101 24 Left 937046090 2:118852793-118852815 CCCGCGCCGGGCGCAGAGGGCGC No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data
937046095_937046101 2 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046101 2:118852840-118852862 GCCGCTCGCGGGTTTGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr