ID: 937046102

View in Genome Browser
Species Human (GRCh38)
Location 2:118852841-118852863
Sequence GCCGCCTGCAAACCCGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046102_937046106 -7 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046106 2:118852857-118852879 AGGCGGCCTTCGGGCTGCGCGGG No data
937046102_937046117 30 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046117 2:118852894-118852916 CGACGCAGGGCCCCTTGGCTCGG No data
937046102_937046111 16 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046111 2:118852880-118852902 GATGTCCGGGAGCCCGACGCAGG No data
937046102_937046110 3 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046110 2:118852867-118852889 CGGGCTGCGCGGGGATGTCCGGG No data
937046102_937046109 2 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046109 2:118852866-118852888 TCGGGCTGCGCGGGGATGTCCGG No data
937046102_937046112 17 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046112 2:118852881-118852903 ATGTCCGGGAGCCCGACGCAGGG No data
937046102_937046105 -8 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046105 2:118852856-118852878 CAGGCGGCCTTCGGGCTGCGCGG No data
937046102_937046114 25 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046114 2:118852889-118852911 GAGCCCGACGCAGGGCCCCTTGG No data
937046102_937046107 -6 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046107 2:118852858-118852880 GGCGGCCTTCGGGCTGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046102 Original CRISPR GCCGCCTGCAAACCCGCGAG CGG (reversed) Intergenic