ID: 937046104

View in Genome Browser
Species Human (GRCh38)
Location 2:118852848-118852870
Sequence CGGGTTTGCAGGCGGCCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046099_937046104 -5 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046104 2:118852848-118852870 CGGGTTTGCAGGCGGCCTTCGGG No data
937046095_937046104 10 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046104 2:118852848-118852870 CGGGTTTGCAGGCGGCCTTCGGG No data
937046097_937046104 -4 Left 937046097 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
Right 937046104 2:118852848-118852870 CGGGTTTGCAGGCGGCCTTCGGG No data
937046094_937046104 26 Left 937046094 2:118852799-118852821 CCGGGCGCAGAGGGCGCCAGGGT No data
Right 937046104 2:118852848-118852870 CGGGTTTGCAGGCGGCCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046104 Original CRISPR CGGGTTTGCAGGCGGCCTTC GGG Intergenic