ID: 937046107

View in Genome Browser
Species Human (GRCh38)
Location 2:118852858-118852880
Sequence GGCGGCCTTCGGGCTGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046102_937046107 -6 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046107 2:118852858-118852880 GGCGGCCTTCGGGCTGCGCGGGG No data
937046099_937046107 5 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046107 2:118852858-118852880 GGCGGCCTTCGGGCTGCGCGGGG No data
937046095_937046107 20 Left 937046095 2:118852815-118852837 CCAGGGTGCAAACACCCGAACTG No data
Right 937046107 2:118852858-118852880 GGCGGCCTTCGGGCTGCGCGGGG No data
937046097_937046107 6 Left 937046097 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
Right 937046107 2:118852858-118852880 GGCGGCCTTCGGGCTGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046107 Original CRISPR GGCGGCCTTCGGGCTGCGCG GGG Intergenic