ID: 937046112

View in Genome Browser
Species Human (GRCh38)
Location 2:118852881-118852903
Sequence ATGTCCGGGAGCCCGACGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046099_937046112 28 Left 937046099 2:118852830-118852852 CCGAACTGTCGCCGCTCGCGGGT No data
Right 937046112 2:118852881-118852903 ATGTCCGGGAGCCCGACGCAGGG No data
937046108_937046112 -5 Left 937046108 2:118852863-118852885 CCTTCGGGCTGCGCGGGGATGTC No data
Right 937046112 2:118852881-118852903 ATGTCCGGGAGCCCGACGCAGGG No data
937046102_937046112 17 Left 937046102 2:118852841-118852863 CCGCTCGCGGGTTTGCAGGCGGC No data
Right 937046112 2:118852881-118852903 ATGTCCGGGAGCCCGACGCAGGG No data
937046097_937046112 29 Left 937046097 2:118852829-118852851 CCCGAACTGTCGCCGCTCGCGGG No data
Right 937046112 2:118852881-118852903 ATGTCCGGGAGCCCGACGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046112 Original CRISPR ATGTCCGGGAGCCCGACGCA GGG Intergenic