ID: 937046849

View in Genome Browser
Species Human (GRCh38)
Location 2:118856233-118856255
Sequence CTGAGGGCGTTGGATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937046843_937046849 15 Left 937046843 2:118856195-118856217 CCCGCTGCTCTCTGGGCCTCAGT No data
Right 937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG No data
937046838_937046849 28 Left 937046838 2:118856182-118856204 CCCTGGGCGGAACCCCGCTGCTC No data
Right 937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG No data
937046839_937046849 27 Left 937046839 2:118856183-118856205 CCTGGGCGGAACCCCGCTGCTCT No data
Right 937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG No data
937046844_937046849 14 Left 937046844 2:118856196-118856218 CCGCTGCTCTCTGGGCCTCAGTG No data
Right 937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG No data
937046842_937046849 16 Left 937046842 2:118856194-118856216 CCCCGCTGCTCTCTGGGCCTCAG No data
Right 937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG No data
937046845_937046849 -1 Left 937046845 2:118856211-118856233 CCTCAGTGTTCTTATTCGTAAAC No data
Right 937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937046849 Original CRISPR CTGAGGGCGTTGGATGAGAT TGG Intergenic
No off target data available for this crispr