ID: 937047061

View in Genome Browser
Species Human (GRCh38)
Location 2:118857483-118857505
Sequence GCAAACTCTCGACCACACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937047061_937047073 23 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047073 2:118857529-118857551 GGTCCCACTTGCGGCCGGCTGGG No data
937047061_937047067 2 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047067 2:118857508-118857530 CCGCTCCCGCTAGGGCAGCGAGG No data
937047061_937047070 14 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047070 2:118857520-118857542 GGGCAGCGAGGTCCCACTTGCGG No data
937047061_937047063 -7 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047063 2:118857499-118857521 AGTTTGCGCCCGCTCCCGCTAGG No data
937047061_937047064 -6 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047064 2:118857500-118857522 GTTTGCGCCCGCTCCCGCTAGGG No data
937047061_937047072 22 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047072 2:118857528-118857550 AGGTCCCACTTGCGGCCGGCTGG No data
937047061_937047077 29 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047077 2:118857535-118857557 ACTTGCGGCCGGCTGGGGCATGG No data
937047061_937047074 24 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047074 2:118857530-118857552 GTCCCACTTGCGGCCGGCTGGGG No data
937047061_937047071 18 Left 937047061 2:118857483-118857505 CCTCCGTGTGGTCGAGAGTTTGC No data
Right 937047071 2:118857524-118857546 AGCGAGGTCCCACTTGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937047061 Original CRISPR GCAAACTCTCGACCACACGG AGG (reversed) Intergenic