ID: 937056702

View in Genome Browser
Species Human (GRCh38)
Location 2:118943643-118943665
Sequence TCCCTTTATCCTTTAAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937056702_937056711 17 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056711 2:118943683-118943705 GTTAGTGCCTGGGGCGGGGTGGG No data
937056702_937056710 16 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056710 2:118943682-118943704 AGTTAGTGCCTGGGGCGGGGTGG No data
937056702_937056708 12 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056708 2:118943678-118943700 AAGAAGTTAGTGCCTGGGGCGGG No data
937056702_937056709 13 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056709 2:118943679-118943701 AGAAGTTAGTGCCTGGGGCGGGG No data
937056702_937056705 7 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056705 2:118943673-118943695 AGAGAAAGAAGTTAGTGCCTGGG No data
937056702_937056704 6 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056704 2:118943672-118943694 TAGAGAAAGAAGTTAGTGCCTGG No data
937056702_937056707 11 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056707 2:118943677-118943699 AAAGAAGTTAGTGCCTGGGGCGG No data
937056702_937056706 8 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056706 2:118943674-118943696 GAGAAAGAAGTTAGTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937056702 Original CRISPR TCCCTTTATCCTTTAAACTT TGG (reversed) Intronic