ID: 937056703 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:118943668-118943690 |
| Sequence | GCACTAACTTCTTTCTCTAA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937056703_937056710 | -9 | Left | 937056703 | 2:118943668-118943690 | CCGTTAGAGAAAGAAGTTAGTGC | No data | ||
| Right | 937056710 | 2:118943682-118943704 | AGTTAGTGCCTGGGGCGGGGTGG | No data | ||||
| 937056703_937056711 | -8 | Left | 937056703 | 2:118943668-118943690 | CCGTTAGAGAAAGAAGTTAGTGC | No data | ||
| Right | 937056711 | 2:118943683-118943705 | GTTAGTGCCTGGGGCGGGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937056703 | Original CRISPR | GCACTAACTTCTTTCTCTAA CGG (reversed) | Intronic | ||