ID: 937056703 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:118943668-118943690 |
Sequence | GCACTAACTTCTTTCTCTAA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937056703_937056711 | -8 | Left | 937056703 | 2:118943668-118943690 | CCGTTAGAGAAAGAAGTTAGTGC | No data | ||
Right | 937056711 | 2:118943683-118943705 | GTTAGTGCCTGGGGCGGGGTGGG | No data | ||||
937056703_937056710 | -9 | Left | 937056703 | 2:118943668-118943690 | CCGTTAGAGAAAGAAGTTAGTGC | No data | ||
Right | 937056710 | 2:118943682-118943704 | AGTTAGTGCCTGGGGCGGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937056703 | Original CRISPR | GCACTAACTTCTTTCTCTAA CGG (reversed) | Intronic | ||