ID: 937056703

View in Genome Browser
Species Human (GRCh38)
Location 2:118943668-118943690
Sequence GCACTAACTTCTTTCTCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937056703_937056711 -8 Left 937056703 2:118943668-118943690 CCGTTAGAGAAAGAAGTTAGTGC No data
Right 937056711 2:118943683-118943705 GTTAGTGCCTGGGGCGGGGTGGG No data
937056703_937056710 -9 Left 937056703 2:118943668-118943690 CCGTTAGAGAAAGAAGTTAGTGC No data
Right 937056710 2:118943682-118943704 AGTTAGTGCCTGGGGCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937056703 Original CRISPR GCACTAACTTCTTTCTCTAA CGG (reversed) Intronic