ID: 937056711

View in Genome Browser
Species Human (GRCh38)
Location 2:118943683-118943705
Sequence GTTAGTGCCTGGGGCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937056699_937056711 23 Left 937056699 2:118943637-118943659 CCTCTTCCAAAGTTTAAAGGATA No data
Right 937056711 2:118943683-118943705 GTTAGTGCCTGGGGCGGGGTGGG No data
937056703_937056711 -8 Left 937056703 2:118943668-118943690 CCGTTAGAGAAAGAAGTTAGTGC No data
Right 937056711 2:118943683-118943705 GTTAGTGCCTGGGGCGGGGTGGG No data
937056702_937056711 17 Left 937056702 2:118943643-118943665 CCAAAGTTTAAAGGATAAAGGGA No data
Right 937056711 2:118943683-118943705 GTTAGTGCCTGGGGCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937056711 Original CRISPR GTTAGTGCCTGGGGCGGGGT GGG Intronic