ID: 937057620

View in Genome Browser
Species Human (GRCh38)
Location 2:118952717-118952739
Sequence GTAAGGGACCAAGACCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937057620_937057629 6 Left 937057620 2:118952717-118952739 CCAGGTGGGTCTTGGTCCCTTAC No data
Right 937057629 2:118952746-118952768 GGCCACCGCAAGAGGTGGTGTGG No data
937057620_937057624 -2 Left 937057620 2:118952717-118952739 CCAGGTGGGTCTTGGTCCCTTAC No data
Right 937057624 2:118952738-118952760 ACCCCTGAGGCCACCGCAAGAGG No data
937057620_937057632 25 Left 937057620 2:118952717-118952739 CCAGGTGGGTCTTGGTCCCTTAC No data
Right 937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG No data
937057620_937057628 1 Left 937057620 2:118952717-118952739 CCAGGTGGGTCTTGGTCCCTTAC No data
Right 937057628 2:118952741-118952763 CCTGAGGCCACCGCAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937057620 Original CRISPR GTAAGGGACCAAGACCCACC TGG (reversed) Intronic
No off target data available for this crispr